August 30, 2025 – Primaryamine

Oduct of 461 base pairs (bp) encompassing exon 13 of KCNQ3 was amplified

Chemexpress August 30, 2025 0 Comments

Oduct of 461 base pairs (bp) encompassing exon 13 of KCNQ3 was amplified working with primers KCNQ3_13a: TATTCCAAACCCTTATCTCAT and KCNQ3_13b: AAACAGGTGGGG CTATTA. PCR fragments amplified from the WT allele had…

Oduct of 461 base pairs (bp) encompassing exon 13 of KCNQ3 was amplified

You Missed

2′,3′,5′-Tri-O-benzoyl-2-thiouridine (CAS 21052-18-6)

(2E)-3-(4-hydroxy-3-methoxyphenyl)-2-phenylacrylic acid

[1-(3,4-dichlorophenyl)-3,5-dimethyl-1H-pyrazol-4-yl]acetic acid

(2E)-2-(hydroxyimino)-N-(4-methoxyphenyl)acetamide